• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The gonadotropin inhibiting hormone (gnih) and its use to control puberty, reproduction, ingestion and growth in fish. The sea bass, dicentrarchus labrax, is one of the most cultivated species in the eu. A problem in their culture is the advancement of puberty, which leads to poor growth and deterioration in the quality of the meat. The present invention is part of the biotechnology sector (aquaculture application sector). The invention relates the cloning strategy of the gonadotrophin inhibitor hormone (gnih) of sea bass, which contains two new peptides from the rfamide family. These peptides have been synthesized and used to generate specific antibodies and have been shown to have inhibitory effects on different neuroendocrine and endocrine factors that control the reproduction of sea bass. This invention may be of interest to control puberty, reproduction, ingestion and growth of fish. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2561708A1
    申请号:ES201400644
    申请日:2014-07-31
    公开日:2016-02-29
    发明作者:José Antonio MUÑOZ CUETO；José Antonio PAULLADA SALMERON
    申请人:Universidad de Cadiz；
    IPC主号:
    专利说明:

    Gonadotrophin secretion (GTHs), being its functional antagonist in fish dopamine, which inhibits the secretion of these adenohypophyseal hormones that control reproduction (GTHs), as demonstrated in the golden carpín (Peter and Paulencu, 1980; Chang and Peter, 1983 ; Chang et al., 1983). The existence of a dopaminergic inhibition of gonadotrophin secretion has been demonstrated in other species of teleost fish, such as eel, catfish, trout, tilapia, coho salmon, carp or mujol (Van Asselt et al ., 1988; Levavi-Sivan et al., 2003; Vidal et al., 2004; Dufour et al., 2005; Aizen et al., 2005). This knowledge allowed the use of GnRH and the development of agonist and antagonistic compounds of GnRH and / or dopamine (pimozide, domperidone), as well as methods of combining and administering them to control the reproductive process of fish in aquaculture practice, as reflected in patents US5288705A, EP0368000B 1, US5643877 A, WO 1996017619A9, US6210927Bl, US7958848B2, among others. However, dopamine does not appear to operate in other teleost fish, particularly marine fish such as sea bass and other perciform fish (Copeland and Thomas, 1989; King et al., 1994; Holland et al., 1998b; Zohar and Mylonas, 2001 ; Prat et al., 2001).
    Gonadotrophin Inhibitory Hormone (GnIH)
    In 2000, a small hypothalamic peptide of 12 amino acids was identified in birds that acted directly on the pituitary gland by inhibiting the synthesis and release of gonadotrophins (Tsutsui et al., 2000; Tsutsui et al., 2007), so it was called the hormone Gonadotropin inhibitor or GnIH.
    The precursor of the protein encoding the GnIH gene originates 2 or 3 possible mature peptides, depending on the species, characterized by a Cterminal end that contains the amino acid sequence LPQRFamide, which can vary by one or two amino acids depending on the species studied. Of the possible peptides that are encoded by the GnIH gene, only those that have a role in inhibiting gonadotrophin secretion are referred to as GnIH.
    The GnIH family includes different peptides, which, depending on the phylogenetic group, have received different names. Thus, in mammals the RFRP-1, RFRP-2 and RFRP-3 peptides are characterized; in birds, a GnIH peptide has been described, and two GnIH-related peptides called GnIHRP-1 and GnIHRP-2; in frogs the GnIH peptide has been designated as fGRP, and related peptides encoded by this precursor as fGRP-RP-1, fGRP-RP2; In teleost fish, such as zebrafish or goldfish, three possible GnIH peptides, called LPXRFa-l, LPXRFa-2 and LPXRFa-3, may be described as X = L or Q (Parhar et al., 2012 ).
    The identification and cerebral location of this neuropeptide, through ELISA techniques, immunohistochemical techniques, in situ hybridization techniques (Tsutsui et al., 2000; Tsutsui and Ukena, 2006; Tsutsui et al., 2007), as well as the fiber distribution In areas where gonadotrophin-releasing cells are located, they suggest that GnIH has a modulating effect on the synthesis and release of GnRH itself, in addition to exerting its direct inhibitor effector on the secretion of gonadotrophins (luteinizing hormone (LH) and hormone stimulating follicle (FSH)) as demonstrated in vertebrates such as birds and mammals. In addition to the aforementioned 10, GnIH also prevents gonadal development, steroid synthesis and spermatogenic activity in birds, 10 which suggests that this neuropeptide can act at different levels of the reproductive axis (Tsutsui et al., 2007; Bentley et al ., 2009).
    The presence of GnIH cells in the posterior hypothalamus seems to be a conserved characteristic throughout the evolution of vertebrates (Tsutsui et al., 2007). Thus, the presence of a similar peptide of the LPXRF-amide type in fish has recently been revealed (Sawada et al., 2002; Osugi et al., 2006; Tsutsui et al., 2007). The location of the peptide of the LPXRF-amide type (homologous to the GnIH of birds and mammals) in fish, including European sea bass, has allowed characterizing its presence in cells of brain areas such as the olfactory bulb / terminal nerve, and in the preoptic area, areas where GnRH-III and GnRH-I type cells are located, respectively (González-Martínez et al., 2001, 2002). GnIH cells have also been located in the region of the mesencephalic tegment, where GnRH-II type cells are found (González-Martínez et al., 2001, 2002). The presence of GnIH innervation in neuroendocrine areas related to reproduction such as the preoptic area and the hypothalamus, GnIH innervation present in the pituitary gland and GnIH expression in sea bass gonads, suggests that GnIH may also be exerting inhibitory effects. at different levels of the reproductive axis in perciform fish and, more specifically, in European sea bass, where our study has focused.
    The relationship between reproductive function and energy balance is well established and, as a general rule, those peptides that stimulate intake suppress reproductive function and vice versa. Recent studies have shown that in addition to its reproductive functions, GnIH can also have a stimulating effect on food intake. This stimulatory effect has been observed in different species of birds (Tachaibana et al., 2005, 2008) and rodents (Johnson et al., 2007; Johnson and Fraley, 2008, Murakami et al., 2008). However, treatment with human GnIH in roosters has an inhibitory effect on intake (eline et al., 2008), 10 which suggests the species-specific importance of the amino acid sequence of GnIH for its physiological effect. The finding of GnIH projections in sheep's brain in the environment of neuropeptide-secreting cells Y (NPY) and propiomelacortins (POMC), agrees with the described effect of GnIH on food intake and suggests that these interactions may mediate these effects (Qi et al., 2009). For all the above, GnIH seems to be a multifunctional neuropeptide, which controls the balance between reproduction, intake and growth.
    Issue raised.
    World food production should grow 70% between 2010 and 2050. In relation to food of aquatic origin, more than half of the total consumed today in the world comes from aquaculture farms. In 2030 it is estimated
    That this production is around 65%. Thus, aquaculture fish production in the European Union in 2011 was 647,156 Tons, with Spain being the EU Member State with the highest volume of aquaculture production with 271,963
    t. in 2011, 7.8% more than in 2010 (compared to 2.3% increase in fishing) and with an economic value of 457 million euros, 9.7% more than in 2010 (APROMAR 2013 Report) .
    The sea bass, Dicentrarchus labrax, is next to the sea bream, one of the species that sustains the production of marine aquaculture in Andalusia, in Spain and in Europe. Among the main aquaculture species of the European Union, sea bass was in 6th place in terms of production (73,196 tons), and in 5th place in terms of economic value (almost 400 million euros). In the Community of Andalusia, sea bass accumulated in 2012 66% of fish production, with 4,150 tons and a value of 29.4 million euros.
    However, although the cultivation of sea bass is currently widely distributed, the controlled reproduction of this species and its production are manifestly improvable. In the case of sea bass, one of the main problems that arise is the advancement of puberty and the first reproduction in growing conditions, particularly in males. This aspect must be taken into account by its practical implication in the productivity of the farms (Carrillo et al., 1993; 1995; 2009). Early gonadal development leads to poor growth and a deterioration in meat quality, as has been shown in salmonids, carp, sea bass and cod, because in these species it is convenient to suppress or delay puberty to allow for greater growth. adequate somatic of the animal.
    In addition, it should be borne in mind that temperature represents a limiting factor in the reproduction of this species. Ovulations and laying in females only occur spontaneously when the temperature range is 9-17 ° C, and above 16-17 ° C the laying is blocked even though the females have reached maturation (Carrillo et al., 2009). This implies in many cases the need to cool water in aquaculture facilities, with the consequent cost
    economic. However, the mechanisms by which elevated temperatures inhibit the reproductive process are still unclear.
    Therefore, the present invention focuses on the cloning and characterization of the gonadotrophin inhibitor hormone or GnIH, synthesis of mature S peptides sbGnIH-l and sbGnIH-2, generation of specific antibodies against sbGnIH-l and sbGnIH peptides -2, its use to identify GnIH cells and their projections, as well as in determining the effects of GnIH on European sea bass Dicentrarchus 1abrax. These generated tools can be very useful to solve these problems of precocious puberty in sea bass
    10 and to elucidate the mechanisms by which reproduction in sea bass is inhibited, providing the possibility of generating functional GnIH antagonists that are used to favor the reproduction of this species. Bibliographic references used
    one. Aizen, J., 1. Meiri, 1. Tzchori, B. Levavi-Sivan, H. Rosenfeld, 2005. Enhancing spawning in the gray mullet (Mugil cephalus) by removal of dopaminergic inhibition. Gene Comp Endocrinol I42: 2l2-221.
    2. APPROVE. 2013. Marine Fish Aquaculture in Spain 2013. European Fisheries Fund (European Union), Ministry of Environment and Rural and Marine Affairs
    3. Bentley GE, Ubuka T, McGuire NL, Calisi R, Perfito N, Kriegsfeld LJ, Wingfield JC, Tsutsui K. 2009. Gonadotrophin-inhibitory hormone: a multifunctional neuropeptide. J Neuroendocrinol. 21: 276-281.
    Four. Carrillo, M., S. Zanuy, F. Prat, R. Serrano, N. R. Bromage. 1993. Environmental induction of spawning in sea bass, pp. 43-54 in Recent advances in Aquaculture, vol 4, edited by R. J. Roberts and 1. Muir. Blackwell Scientific publications, London.
    5. Carrillo, M., S. Zanuy, F. Prat, 1. Cerdá, J. Ramos, E. Mañanós, N. Bromage. 1995. Sea bass, pp. 138-168 in Broodstock management and egg and larval quality, edited by N. R. Bromage and R. 1. Roberts. Blackwell, Oxford, U.K.
    6. Carrillo M., Zanuy S., Bayarri M.J. 2009. Environmental control of fish reproduction with special reference to the control of the sexual cycle, puberty and precocity. Chapter 3. In "The Reproduction of fish: basic aspects and their applications in aquaculture". Manuel Adrian Carrillo Estévez (Coordinator), Juan Espinosa de los Monteros (Scientific Editor). Series: Scientific and Technological Publications of the Spanish Aquaculture Observatory Foundation. Spanish Aquaculture Observatory Foundation, Higher Council for Scientific Research and Ministry of Environment and Marine Rural Environment. Madrid. ISBN: 978-6-1. pp: 173-246.
    7. Chang, JE, Peter, RE. 1983. Effects of pimozide and Des GlylO, (D Ala6) luteinizing hormone-releasing hormone ethyalmide on serum gonadotropin
    concentration, germinal vesicle migration, and ovulation in female goldfish, Carassius auratus. Endocrinol Comp gene. 52: 30-37
    8. Chang, lP, Cook, RE, Peter, RE. 1983. Influence of catecholamines on gonadotropin secretion in goldfish, Carassius auratus. Endocrinol Comp gene.
    49: 22-31
    9. Cline, M.A., Bowden, C.N., Calchary, W.A., Layne, l.E., 2008. Short-term anorexigenic effects of central neuropeptide VF are associated with hypothalamic changes in chicks. lournal of Neuroendocrinology 20, 971
    977
    10. Copeland, P.A., Thomas, P. 1989. Control of gonadotropin release in the Atlantic croaker Micropogonias undulatus: evidence for lack of dopaminergic inhibition. Gen. Comp. Endocrinol 74,474-483.
    eleven. Dufour, S., F.-A. Weltzien, M.-E. Sebert, N. Le Belle, B. Vidal, P. Vernier,
    C. Pasqualini. 2005. Dopaminergic inhibition of reproduction in teleost fishes: ecophysiological and evolutionary implications. Ann NY Acad Sci 1040: 9-22.
    12. González-Martínez, D., Madigou, T., Zmora, N., Anglade, l., Zanuy, S., Zohar, Y., Elizur, A., Muñoz-Cueto, l.A. and Kah, O. 2001. Differential expression of three different prepro-GnRH (Gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). l. Comp. Neurol 429: 144-155.
    13. González-Martínez D., Zmora N., Mañanos E., Saligaut D., Zanuy S., Zohar Y., Elizur A., Kah O. and Muñoz-Cueto l. A. 2002. Immunohistochemical localization of three different prepro-GnRHs (Gonadotrophin-releasing hormones) in the brain and pituitary of the European sea bass (Dicentrarchus labrax) using antibodies to the corresponding GnRH-associated peptides. 1. Comp. Neurol 446: 95-113.
    14. Holland, M.C.H., and. Gothilf, 1. Meiri, lA. King, K. Okuzawa, A. Elizur, Y. Zohar. 1998a. Levels of the native forms of GnRH in the pituitary of the
    gilthead seabream, Sparus aurata, at several characteristic stages of the gonadal cyc1e. Gene Comp Endocrinoll12: 394-405.
    fifteen. Holland, M.C., S. Hassin, Y. Zohar. 1998b. Effects of long-term testosterone, gonadotropin-releasing hormone agonist, and pimozide treatments on gonadotropin II levels and ovarian development in juvenile female striped bass (Morone saxatilis). Biol Reprod 59: 1153-1162.
    16. Johnson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide3 stimu-lates GH secretion inhibits LH secretion, and has variable effects on sex behavior in the adult mal e rat. Hormones and Behavior 51, 171-180.
    17. Johnson, M.A., Fraley, G.S., 2008. Rat RFRP-3 alters hypothalamic GHRH expression and growth hormone secretion but does not affect KiSS-l gene expression or the onset of puberty in male rats. Neuroendocrinology 88, 305
    315
    18. Kah, O., J.G. Dulka, P. Dubourg, J. Thibault, R.E. Peter 1987. Neuroanatomical substrate for the inhibition of gonadotropin secretion in goldfish: existence of a dopaminergic preoptico-hypophyseal pathway. Neuroendocrinology 45: 451-458.
    19. Kah, O., J.M. Danger, P. Dubourg, G. Pelletier, H. Vaudry, A. Calas. 1989. Characterization, cerebral distribution and gonadotropin-release activity of neuropeptide Y (NPY) in the goldfish. Fish Physiol Biochem 7: 69-76.
    twenty. Kah, O., V.L. Trudeau, B.D. Sloley, P. Dubourg, J.P. Chang, K.L. Yu, R.E. Peter 1992. Involvement of GABA in the neuroendocrine regulation of gonadotrophin release in the goldfish.Neuroendocrinology 55: 396-404.
    twenty-one. Kah, O., 1. Anglade, E. Leprétre, P. Dubourg, D. de Monbrison. 1993. The reproductive brain in fish. Fish Physiol Biochem 11: 85-98.
    22 King, W.V., Thomas, P., Harrell, R.M., Hodson, R.G., Sullivan, C.V. 1994. Plasma levels of gonadal steroids during final oocyte maturation of striped bass, Morone saxatilis L. Gen. Comp. Endocrinol 95,178-191.
    2. 3. Levavi-Sivan, B., A. Avitan, T. Kanias, 2003. Characterization of the inhibitory dopamine receptor from the pituitary of tilapia. Fish Physiol Biochem 28: 73-75.
    24. Osugi, T., K. Ukena, S.A. Sower, H. Kawauchi, K. Tsutsui. 2006. Evolutionary origin and divergence of PQRFamide peptides and LPXRFamide peptides in the RFamide peptide fami1y. Insights from novel lamprey RFamidepeptides. FEBS J. 273: 1731-1743.
    25. Parhar 1., Ogawa S., Kitahashi T. 2012 RFamide peptides as mediators in environmental control of GnRH neurons. Progress in Neurobiology 98: 176
    196
    26. Peter, RE, Paulencu, C. 1980. Involvement of the preoptic region in gonadotropin release-inhibition m goldfish, Carassius auratus. Neuroendocrinology 31: 133-141
    27. Prat, F., S. Zanuy, M. Carrillo, 2001 Effect of gonadotropin-releasing honnone analogue GnRHa and pimozide on plasma levels of sex steroids and ovarian development in sea bass Dicentrarchus labrax L. Aquaculture 198: 325-338
    28. Qi, Y., Oldfield, B.J., Clarke,! .J., 2009. Projections of RFamide-related peptide-3 neurons in the ovine hypothalamus, with special reference to regions regulating energy balance and reproduction. Journal of Neuroendocrinology 21,690-697.
    29. Sawada, K., K. Ukena, H. Satake, E. Iwakoshi, H. Minakata, K. Tsutsui. 2002. Novel fish hypothalamic neuropeptide: Cloning of a cDNA encoding the precursor polypeptide and identification and localization of the mature peptide. Eur J Biochem 269: 6000-6008.
    30 Tachibana, T., Sato, M., Takahashi, H., Ukena, K., Tsutsui, K., Furuse, M., 2005. Gonadotropin-inhibiting honnone stimulates feeding behavior in chicks. Brain Research 1050.94-100.
    31. Tachibana, T., Masuda, N., Tsutsui, K., Ukena, K., Ueda, H., 2008. The orexigenic effect of GnIH is mediated by central opio id receptors in chicks. Comparative Bio-chemistry and Physiology Part A: Molecular & Integrative Physiology 150,21-25.
    32 Trudeau, V.L. 1997. Neuroendocrine regulation of gonadotrophin II release and gonadal growth in the goldfish, Carassius auratus. Rev Reprod 2: 55-68.
    33. Tsutsui, K., and K. Ukena. 2006. Review: Hypothalamic LPXRF-amide peptides in vertebrates: identification, 10calization and hypophysiotropic activity. Peptides 27: 1121-1129.
    3. 4. Tsutsui, K., E. Saigoh, K. Ukena, H. Teranishi, Y. Fujisawa, M. Kikuchi, S. Ishii, P.l Sharp. 2000. A novel avian hypotha1amic peptide inhibiting gonadotropin release. Biochem Biophys Res Commun 275: 661-667.
    35 Tsutsui, K., G.E. Bentley, T. Ubuka, E. Saigoh, H. Yin, T. Osugi, K. Inoue,
    V.S. Chowdhury, K. Ukena, N. Cycone, P.J. Sharp, lC. Wingfie1d. 2007. The general and comparative biology of gonadotropin-inhibitory hormone (GnIH). Gene Comp Endocrinol153: 365-370.
    36. Van Asselt, L.A., H.J. Goos, W. Smit-van Dijk, P.A.M. Speetjens, P.G. Van Oordt 1988. Evidence for the involvement of D2 receptors in the dopaminergic inhibition of gonadotropin release in the African catfish, C1arias gariepinus. Aquaculture; 72: 369-378.
    37. Vidal, B., C. Pasqualini, N. Le BeBe, M.C.H. HoBand, M. Sbaihi, P. Vernier,
    Y. Zohar, S. Dufour, 2004 Dopamine inhibits 1uteinizing hormone synthesis and release in the juvenile European eel: a neuroendocrine lock for the onset of public. Biol Reprod 71: 1491-1500.
    38. Zohar, Y., C.C. Mylonas 2001 Endocrine manipulations of spawning In cultured fish: from hormones to genes. Aquaculture 197: 99-136.
    39. Zohar Y., Muñoz-Cueto l., Elizur A., Kah 0.2010. Neuroendocrinology of reproduction in teleost fish. Endocrine Gene Comp! 165: 438-455. BRIEF DESCRIPTION OF THE INVENTION
    The present invention refers to the finding and isolation of the DNA copy of a new neuropeptide corresponding to the precursor of the gonadotropin inhibitor hormone (GnIH or LPXRFa) in perciform fish and, more specifically, in European sea bass, Dicentrarchus labrax. In addition, we have designed and synthesized from said precursor two mature peptides called sbGnIH-1 or sbLPXRFa-l and sbGnIH-2 or sbLPXRFa-2. These peptides have been modified with an e-terminal amidation and an N-terminal cysteine residue for coupling to KLH, in order to favor the immunization process and the generation of specific antibodies against GnIH-1 and GnIH-2. sea bass in rabbits (anti-sbGnIH-l and anti-sbGnIH-2) and in goats (anti-sbGnIH-2). These antibodies have been used to characterize the localization pattern of GnIH-immunopositive cells and their projections in the brain and the pituitary gland of sea bass. The invention also includes injection assays that demonstrate a clear inhibitory effect of GnIH on different neuroendocrine and endocrine factors that control the reproductive process of sea bass.
    This invention has allowed us to deepen our knowledge of the mechanisms by which reproduction in sea bass is controlled and inhibited. This invention can be very useful to control the puberty of sea bass and solve the problems of precocious puberty in males of this species. Since early gonadal development leads to poor growth and a deterioration in meat quality, suppressing or delaying puberty can allow greater somatic growth of the animal, with the consequent benefits for production in aquaculture practice. Also, this invention opens the possibility of using the copy DNA and the specific antibodies generated to block the inhibitory effects of GnIH on reproduction, as well as generate functional antagonists of GnIH that are used to promote gonadal development, maturation, laying and favor the reproduction of the sea bass. Therefore, the application of this invention will solve real problems that occur in the aquaculture of sea bass and that affect the reproduction and growth of this species. In addition, it is expected that these generated tools can be applied to species close to sea bass and, in particular, to percomorphic fish such as sea bream, serious fish, sea bass or tuna.
    DETAILED DESCRIPTION OF THE INVENTION
    1. Cloning and characterization of the DNA copy of the GnIH of sea bass
    For the cloning of the GnIH of sea bass, we started from a brain expression library and followed a strategy based on the use of degenerate primers for PCR amplification on it. PCR amplification and subsequent electrophoresis allowed bands of the expected size to be identified. These bands were isolated, the nucleic acids were eluted and the sequencing of these DNA fragments and their subsequent comparison and alignment with the GnIH sequences of other species available in the databases allowed us to determine that it was a partial sequence of the precursor of the gonadotrophin inhibitor hormone of sea bass (GnIH or precursor LPXRFamide).
    Subsequently, using specific oligonucleotides designed from the partial cloned sequence of sea bass, and by modifying the 5'and 3 'ends and using commercial kits (SMARTer RACE cDNA C10ntech), we obtained the complete sequence of nucleotides that code for the precursor of GnIH (or LPXRFamide precursor) of sea bass. The complete cloned sequence of sea bass GnIH consists of 878 nucleotides (SEQ ID NO 1), of which 600 nucleotides (SEQ ID NO 2) encode the precursor peptide of sea bass GnIH (ORF) of 200 amino acids (SEQ ID NO 3), 49 nucleotides correspond to the 5'UTR end and 226 nucleotides correspond to the 3'UTR end and the poly-A tail. Unlike other vertebrates, in which three possible GnIH peptides have been described, in this seabass precursor we have identified only two possible functional peptides, called sbGnIH-l or sbLPXRFa-l (PLHLHANMPMRF, SEQ ID NO 4) and sbGnIH-2 or sbLPXRFa-2 (SPNSTPNMPQRF, SEQ ID NO 5) (Figure 1 and 2). The phylogenetic analysis clearly identified the cloned sequence in the sea bass within the branch in which the GnIHILPXRFa sequences of fish and other vertebrates are located (Figure 3).
    2. GnIH expression of sea bass in central and peripheral tissues
    Once the sequence was cloned and identified, specific primers were designed to study, by conventional PCR (RT-PCR), the tissue distribution of messenger RNA in central tissues (olfactory bulb, telecephalus, diencephalon, optic ceiling, cerebellum, spinal cord, retina and pituitary gland) and peripherals (heart, liver, kidney, intestine, muscle, ovary and testis) of the sea bass. In central tissues, the expression was very evident in telencephalon, diencephalon, optic ceiling, cerebellum and retina (Figure 4). In peripheral tissues, GnIH messenger RNAs were evidenced in the testis, ovary, kidney and intestine (Figure 4). The expression of GnIH in central sensory areas such as the retina, the optic ceiling and the cerebellum, in neuroendocrine areas of the telencephalon and the diencephalon, as well as in the ovary and the testis reinforce the involvement of GnIH in the control of the reproduction of the sea bass.
    3. Design and synthesis of sbGnIH-I and sbGnIH-2 peptides
    As we have indicated previously, in the sequence of the deduced sea bass GnIH we identify two possible mature peptides, which we have called sbGnIH-I (sbLPXRFa-l) and sbGnIH-2 (sbLPXRFa-2). The next step was to synthesize those peptides, which were modified with an amidation at their C-terminal end, characteristic of the functional GnIH peptides. Both peptides were used for the functional tests that will be detailed later.
    The sequences of the synthesized peptides were as follows:
    sbGnIH-l: NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) sbGnIH-2: NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7)
    The synthesized sbGnIH-1 peptide (12 amino acids) had an estimated molecular weight of 1462.81 Da and an experimental molecular weight of 1461.75 Da, as observed by mass spectrophotometry analysis (Figure 5). This peptide was purified by HPLC, showing a main peak with a retention time of 13.75 minutes, and a purity level of 95.2% (Figure 5). The sequence was verified by tandem mass spectrometry (MSIMS).
    The synthesized sbGnIH-2 peptide (12 amino acids) had an estimated molecular weight of 1374.54 Da and an experimental molecular weight of 1373.65 Da, as observed by mass photometry spectrum analysis (Figure 6). This peptide was purified by HPLC, showing a main peak with a retention time of 13.1 minutes, and a purity level of 95.1% (Figure 6). The sequence was verified by tandem mass spectrometry (MSIMS).
    4. Generation of anti-sbGnIH-l yanti-sbGnIH-2 antibodies
    Likewise, these sbGnIH-1 and sbGnIH-2 peptides have been used for the generation of specific antibodies directed against them, obtained in rabbit and goat. These peptides had a C-terminal amidation and an N-terminal cysteine residue for coupling to KLH, in order to favor the immunization process. In the case of the sbGnIH-1 peptide, the antibodies were generated in rabbit. In the case of the sbGnIH-2 peptide, antibodies were generated in both rabbit and goat. The immunization protocol was as follows:
    Appendix 1. Production of antibodies in rabbit
    Date ImmunizationBleedingSerum
    Week O Pre-serum3 mi + test
    Week 1 I
    Week 5 Il
    Week 9 III
    Week 11 ELISA + test
    Week 11 III + 2v::: 020 mi
    Week 13 IV
    Week 15 IV + 2v + final bleeding50-70 mi + test
    Appendix 2. Production of goat antibodies
    Date ImmunizationBleedingSerum
    Week O Pre-serum3 mi + test
    Week 1 I
    Week 5 Il
    Week 9 III
    Week 11 ELISA + test
    Week 11 III + 2v::: 050 mi + test
    Week 13 IV
    Week 15 IV + 2v + final bleeding50-70 mi + test
    After the immunization period (15 weeks) the animals were bled, the serum was obtained with the antibodies and ELISA tests were performed for titration. NuncImmunoTM Plate MaxiSorpTM Surface ELISA plates coated with free peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a sample dilution range of 1: 121 were used
    1: 161 051 (serum). As secondary antibodies, goat anti-rabbit immunoglobulins obtained in goat (Agrisera) at a 1: 6667 dilution and goat anti-goat Ig immunoglobulins obtained in rabbit (DAKO) at dilution
    1: 10,000
    The ELISA assays obtained show the responses of the antibodies generated against the antigens, in relation to the preimmune serum (Figures 7, 8 and 9), in which the characteristic sigmoid curve is evidenced as a function of serum dilution. All sera generated showed a good titer, with optimal dilution ranges between 1: 7000-1: 11000 for rabbit-generated antibodies (anti-sbGnIH-1 and anti-sbGnIH-2), and 1: 2000-1: 6000 for the antibody generated in goat (anti-sbGnIH-2).
    5. Immunohistoguimic localization of GnIH in the brain and pituitary gland of sea bass
    Obtaining specific antibodies against the sbGnIH-1 and sbGnIH-2 peptides has allowed clarifying the spatial distribution pattern of GnIH cells and their projections by means of immunohitochemical techniques. Immunohistochemical staining revealed a high specific signal when we incubated the sections with the generated antibodies, showing no incspific reaction when incubating with the pre-immune serum or when we suppressed the secondary antibodies. The results obtained were highly consistent and no differences were found in the immunomarking between the antibodies against the GnIH-1 and GnIH-2 peptides in the sea bass specimens analyzed.
    Thus, the anti-sbGnIH-I and anti-sbGnIH-2 sera from sea bass allowed us to perform a complete analysis on serial sections of the brain, from the most rostral portions (olfactory bulbs) to the most caudal (medulla). For both the sbGnIH-I and sbGnIH-2 fonna, we have detected the presence of cell bodies in the olfactory bulb, particularly in the ganglion cells of the tenninal nerve, in the transition between the most caudal area of the olfactory bulb and the most rostral of the telencephalon, differentiating two independent cell populations: a more rostral and dorsal population, in the medial portion of the bulbs and another more caudal and ventral population in the tenninal nerve region. Immunoreactivity was also evident in cells of the central and lateral nuclei of the ventral telencephalon, in the periventricular posterior nucleus of the preoptic area. In addition, we detect large immunoreactive cells in the dorsal-lateral area of the rostral syncephalon. We also found immunoreactive cells in the secondary gustatory nucleus, these cells being in the central zone of the tegment much more numerous and smaller than those described above. In addition, cells were detected in the proximal distal pars and in the parsy of the adenohypophysis.
    Regarding the innervation pattern, we detect sbGnIH-I-and sbGnIH-2 immunoreactive fibers mainly in the anterior and middle brain. The fibers were most evident in the ventral telencephalon, preoptic area, ventral thalamus, mid-basal hypothalamus, lateral recess, optic roof, torus semicircularis, rostrallateral tegment and in the caudal region of the tegment (secondary gustatory nucleus). In addition, we have located fibers in the dorsal telencephalon, the ventral rhomboencephalus, the optic nerve and in the pineal organ, as well as in the proximal distal pars and the paned throat of the adenohypophysis.
    This pattern of distribution of GnIH cells and fibers in olfactory sensory areas (olfactory bulb, tenninal nerve), photosensitive (optic nerve, optic roof) and gustatory (secondary gustatory nucleus), as well as in neuroendocrine areas related to reproduction (ventral telencephalon, preoptic area, midbasal hypothalamus) and in the adenohypophysis itself reinforce the consideration of the involvement of sea bass GnIH in the control of processes such as reproduction, intake and metabolism.
    6. Determination of the effects of GnIH on sea bass
    Once the possible mature GnIH peptides were characterized, an experiment was designed to verify what the in vivo effect of GnIH is on European sea bass. The tests were performed in the form sbGnIH-2. The results obtained showed a marked inhibitory effect of GnIH on various brain and pituitary genes that are involved in the stimulation of reproduction. Thus, we were able to observe a decrease in the expression of messenger RNA in the releasing hormone of gonadotrophins type II (GnRH-2) at 6 hours post-injection (hpi) at all the doses analyzed (1, 2 and 4 ¡. tg) And an inhibition in the expression of GnRH-1 at 12 hpi at the highest dose (4¡tg) (Figure 10). No effects of sbGnIH-2 on messenger RNA levels of the GnRH-3 form of sea bass were observed, at any of the doses and post-injection times analyzed. Kisspeptins were also inhibited after treatment with sbGnIH-2 at 6 hpi (Figure 10). Inhibition of type 1 kisspeptins (Kissl) was evident with the intermediate dose (2 .tg), while in the case of Kiss2 this inhibition took place at the highest dose of 4 .tg (Figure 10). .
    At the pituitary level, a GnIH inhibitory effect was also observed on the expression of follicle stimulating hormone (FSH), which is involved in the initial maturation of oocytes and in vitellogenesis, and on luteinizing hormone (LH), responsible of the final ripening and setting, the effects on the latter being more marked (Figure 11). This inhibitory effect was evident both at 6 hpi (at all doses for LH and at doses of 2 and 4¡tg for FSH) and at 12 hpi (at the dose of 2 ¡.tg for both FSH and LH ) (Figure 11). This inhibition of messenger RNAs of these neuroendocrine and endocrine factors that stimulate reproduction show inactivation of the reproductive axis that causes GnIH at different levels of the brain-pituitary axis of sea bass.
    Therefore, this invention addresses novel aspects of neuroendocrine control of the reproductive process in fish, in general, and in European sea bass 5 in particular. As novelties we can highlight the generation of tools to identify the presence and levels of gonadotrophin inhibitory honnone in sea bass at different stages (larval, juvenile and adult stages) and the development of procedures to characterize the effects of this new neuroendocrine factor in fish We also propose an application of this tool, since this invention provides a methodology to be followed to inhibit the early puberty of this species through the use of GnIH injections or implants. Also, this invention can penetrate the generation of agonists and / or antagonists of GnIH, through the modification of different amino acids of the described sequences, which can be
    15 used to inhibit or stimulate reproduction in adult animals, respectively, with the consequent benefit to control and improve the productivity of this species in aquaculture.
    DESCRIPTION OF THE CONTENT OF THE FIGURES
    Figure 1. 878 nucleotide sequence of the GnIH precursor of European sea bass, Dicentrarchus labrax (SEQ ID NO 1). The sequence has 5'UTR and 3'UTR ends, of 49 nucleotides and 226 nucleotides, respectively. The 600 nucleotide sequence between the atg (first codon, methionine) and the tga (stop codon) marked in gray corresponds to the coding region or ORF (SEQ ID NO 2). The 200 amino acid sequence encoded is shown in uppercase with italics. In bold and underlined, two possible polyadenylation (aataaa) signals present at the 3'UTR end are shown.
    Figure 2. Complete 200 amino acid sequence of the precursor of the European sea bass GnIH (SEQ ID NO 3). The fragment shown corresponds to the coding zone of the isolated nucleotide sequence. Mature peptides sbGnIH-1 or sbLPXRFa-1 (PLHLHANMPMRF, position 94-105, SEQ ID NO 4) and sbGnIH-2 or sbLPXRFa-2 (SPNSTPNMPQRF, position 116-127, SEQ ID NO 5) are marked bold and shaded in gray color Note the processing amino acids of these peptides, which are K or R at the 5 'end, and GR at the 3' end. The stop codon is indicated by an asterisk.
    Figure 3. Phylogenetic tree of the identified precursor of the LPXRFamide peptide and the possible RFamide peptides of other vertebrates. The method used to construct the phylogenetic tree was the "Western-joining method". The data were obtained by 1,000 repetitions, to determine the confidence indices within the phylogenetic tree. GnIH orthologs share the common C-terminal end LPXRFamide (X = L or Q or M in the case of fish) which has been identified in other vertebrates from humans to fish. Sea bass peptides also substitute the amino acid Lysine (L) for the amino acid methionine (M).
    Figure 4. Expression of the GnIH precursor peptide in central and peripheral tissues of sea bass by RT-PCR.
    Figure 5. Synthesis of sea bass sbGnIH-1 peptide, modified with an amidation at its C-terminal end (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6). The analysis is presented by mass spectrophotometry, which shows a peak of 1461.75 Da molecular weight and HPLC analysis, which shows the peak corresponding to sbGnIH-1 with a retention time of 13.75 minutes and a purity of 95.2% The sequence was verified by tandem mass spectrometry (MSIMS).
    Figure 6. Synthesis of sea bass sbGnIH-2 peptide, modified with an amidation at its C-terminal end (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7). The analysis is presented by mass spectrophotometry, which shows a peak of 1373.65 Da molecular weight and HPLC analysis, which shows the peak corresponding to sbGnIH-2 with a retention time of 13.1 minutes and a purity of 95.1% The sequence was verified by tandem mass spectrometry (MSIMS).
    Figure 7. ELISA test of the anti-sbGnIH-1 serum obtained in rabbit. The response obtained in an assay of the anti-sbGnIH-1 serum generated against the preimmune serum of the same rabbit is shown. ELISA plates coated with the sbGnIH-l1ibre peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a serum dilution range of 1: 121-1: 161051 were used. The test shows an optimal titre at dilutions between 1: 9000 and 1: 11500 (linear part of the curve between 1 and 2 absorbance at 650 nm).
    Figure 8. ELISA test of the anti-sbGnIH-2 serum obtained in rabbit. The response obtained in an assay of the anti-sbGnIH-2 serum generated against the preimmune serum of the same rabbit is shown. ELISA plates coated with the free sbGnIH-2 peptide (0.004 mg / ml) and protein (0.002 mg / ml) and a serum dilution range of 1: 121-1: 161051 were used. The assay shows an optimal titer. at dilutions between 1: 7000 and 1: 11 000 (linear part of the curve between 1 and 2 absorbance at 650 nm).
    Figure 9. ELISA test of the anti-sbGnIH-2 serum obtained in goat. It shows
    the response obtained in an anti-sbGnIH-2 serum test generated against the
    Preimmune serum from the same goat. ELISA plates covered with
    the free sbGnIH-2 peptide (0.004 mg / ml) and protein (0.002 mg! ml) and a range of
    S dilution of sera from 1: 121-1: 161051. The test shows an optimal titer at
    dilutions between 1: 2000 and 1: 6000 (linear part of the curve between 1 and 2 of
    absorbance at 650 nm).
    Figure 10. Effect of intracerebroventricular (lCV) treatment with the peptide
    sbGnIH-2 on the expression of GnRH-l, GnRH-2, Kiss-l and Kiss-2 in the brain
    10 of male specimens of European sea bass. The doses used were l¡.tg, 2¡.tg Y
    Total 4¡.tg of sbGnIH-2 dissolved in PBS. Controls were treated only with
    vehicle (PBS). The specimens were sampled at 6 and 12 hours post
    injection (6 hpi and 12 hpi, respectively). The relative expression for genes
    object of study was determined by quantitative PCR, using the 18s gene
    lS as normalizer Each value represents the mean ± standard error of 5
    different individuals (n = 5). The different letters indicate statistical differences
    significant between groups, after applying ANOV A one way (p ::; 0.05) followed by
    Tukey test.
    Figure 11. Effect of intracerebroventricular (lCV) treatment with the peptide
    twenty sbGnIH-2 on FSH and LH expression in the pituitary of male specimens of
    European sea bass. The doses used were 1¡tg, 2¡.tg Y4¡.tg total of sbGnIH-2
    dissolved in PBS. Controls were treated with vehicle only (PBS). The
    specimens were sampled at 6 and 12 hours post-injection (6 hpi and 12 hpi,
    respectively). The relative expression for the genes under study was
    2S determined by quantitative PCR, using the 18s gene as a normalizer.
    Each value represents the mean ± standard error of 5 different individuals (n = 5).
    The different letters indicate significant statistical differences between groups,
    after applying ANO VA one way (p ::; 0.05) followed by the Tukey test. EMBODIMENT OF THE INVENTION
    The cloning strategy described above allowed us to obtain the complete sequence of nucleotides, which code for the precursor of the gonadotrophin inhibitor hormone (GnIH) of sea bass Dicentrarchus 1abrax. The analysis of the amino acid sequence thereof has allowed us to postulate the sequence of two potentially functional mature peptides of the RF-amide family, called sbGnIH-l or sbLPXRFa-1 (NH2PLHLHANMPMRF-CONH2 sequence) and sbGnIH-2 or sbLPXRFa- 2 (NH2SPNSTPNMPQRF-CONH2 sequence). These peptides were synthesized, their molecular weight determined by mass spectrophotometry, purified by HPLC and their sequence verified by tandem mass spectrometry (MSIMS). The activity of these peptides in sea bass was determined by in vivo assays, as described below.
    Animals and sample collection
    A total of 40 sea bass (Dicentrarchus 1abrax), weighing 839.03g ± 10.12g, were obtained at the "Laboratory of Marine Cultures" of the University of Cádiz (Puerto Real, Spain), where they were kept in photoperiod conditions natural, temperature of 19 ° C ± 1 ° C and constant salinity of 39 ppt. The fish were distributed in 8 tanks (5 specimens in each tank) with a total capacity of 1.3 m3 total, a radius of 61 cm and a height of 90 cm. The amount of effective water, taking into account the charge density, was 1 m3.
    To determine the functionality of GnIH on the reproductive axis of sea bass, its effects on the levels of messenger RNA of various genes involved in the estimation of reproduction (GnRH-l, GnRH-2, GnRH-3, Kisspeptin-1) were analyzed. , Kisspeptin-2, FSH and LH) by quantitative PCR. For this, the fish were anesthetized with MS-222 (Sigma St Louis, MO), measured, and weighed. A small incision was made in the skull with a microtota1adra as a way, and they were injected intracerebroventricularly (lCV) with the help of a micromanipulator l! Lg, 2! Lg or 4! Lg of the sbGnIH-2 peptide (NH2SPNSTPNMPQRF-CONH2 ), using PBS as a vehicle. Control individuals were injected exclusively with PBS. The treated individuals and their controls were sacrificed at 6 hours and 9 hours after the injection. The brains and pituitary glands of the specimens were removed by dissection, and the samples were immediately frozen in liquid nitrogen and then stored at -80 ° C until further analysis. The total RNA of the samples was extracted using TRIsure (Bioline, London, United Kingdom) following the manufacturer's recommendations, was quantified by photometry spectrum in a NANODROP (Eppendort) equipment and its purity was evaluated by the absorbance ratio Abs260 nmlAbs280 nm. Total RNA (1 J.1g) was retrotranscribed to copy DNA (cDNA) and genomic DNA was removed using the QuantiTect® Reverse Transcription Kit (Qiagen, Hilden, Germany). The gene expression analysis was carried out in a quantitative PCR equipment, a CFX96 Manager System (Bio-Rad, Alcobendas, Spain) and the SensiF AST SYBR NoROX kit (Bioline, London, United Kingdom). The qPCR reactions were carried out in duplicate in a total volume of 20 J.11, from 5 ng cDNA, with specific primers obtained from the sequences GnRH-1, GnRH-2, GnRH-3, Kisspeptin -l, Kisspeptin-2, FSH and LH of sea bass available in the databases, using the l8S gene of sea bass as a normalizing gene (See Table). The protocol followed in the quantitative PCR was the following: a) Enzyme activation: 950C for 2 minutes; b) 40 cycles: Denaturation at 95 ° C for 10 s; Banding and extension at 60 ° C (GnRH-l, GnRH-3, FSH, LH, l8S); 610C (Kiss-l, Kiss-2) and 63 ° C (GnRH-2), for 25 seconds; C). Melting curve from 70 ° C to 95 ° C every 0.5 ° C for 5 seconds. Melting curves of each sample were generated, to corroborate that they had a single peak and only the gene under study was amplified. To rule out possible water contamination, negative controls were performed by replacing the cDNA with DEPC water. The expression of the genes studied was calculated using the method ~~ Ct. The possible significant differences in the expression of the genes under study between the animals injected with the different doses of sbGnIH-2 (1 µg, 2 µg or 4f! G) and the controls (PBS) at different post-times injection (6 and 12 hours post-injection), were analyzed using the one-way ANOVA statistic, followed by the Tukey test. When the requirements for normality and homogeneity of variance were not satisfied, the
    5 necessary transformations (logarithmic or root transformation) to meet these requirements. The differences were considered significant with P <O.05.
    The results obtained demonstrated the inhibitory effect of sbGnIH-2 on GnRH-1, GnRH-2, Kisspeptin-1, Kisspeptin-2, FSH and LH of sea bass, showing its effectiveness in causing a blockage of the reproductive axis in this species. This evidence demonstrates the usefulness of sea bass GnIH to reduce the incidence of precocious puberty or slow down the reproductive process in sea bass. These inhibitory effects of reproduction can have a positive impact on the growth and productivity of this species in aquaculture practice since it is clearly demonstrated that the energy destined to reproduction represents a limit for
    15 energy resources for growth.
    Table: Primers used in quantitative PCR
    Primer Name Sequence (5 -3 ')
    GnRH1 (F) GGTCCTATGGACTGATCCAGG
    GnRH1 (R) TGATTCCTCTGCACAACCTAA
    GnRH2 (F) TGG.GCfGcttctATGTGT '' ~ /// ", '" <"" »T'X'
    GnRH2 (R) CCAGCTCCCTCTTGCCTC
    GnRH3 (F) TGt ~ GQAGAGCfAGA ~ G ~ C
    GnRH3 (R) GTTTGGGCACTCGCCTCTT
    Kissl (F) GtATCAAfA, CTGGCATCAGCAAAGA
    Kissl (R) TCAACCATTCTGACCTGGGAAACTT
    Kiss2 (F) GGGAGGATTCCAGCCCGTGTTTCT
    Kiss2 (R) GAGGCCGAACGGGTTGAAGTTGAA
    LH ~ (F) TTGAGCTTCC1GA ~ GfCCA
    LH ~ (R) GCAGGCTCTCGAAGGTACAG
    FSH ~ (F) ACCAACATCAGCATttAAGTG
    18S (F) TCAGACCCAAAACCCATGCG
    18S (R) ACCCTGATTCCCCGTTACCC
    权利要求:
    Claims (82)
    [1]
    one. An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) SEQ ID NO 1, or (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).
    [2]
    2. An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) SEQ ID NO 2, or (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).
    [3]
    3. An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a polypeptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 1 to 93, or (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).
    [4]
    Four. An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 94 to 105, or (b) the complementary sequence of said nucleotide sequence, or (c) both
    (a) and (b).
    [5]
    5. An isolated po1inuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 106 to 115, or (b) the
    complementary sequence of said nucleotide sequence, or (c) both
    (a) and (b).
    [6]
    6. An isolated polynuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a peptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 116 to 127, or (b) the complementary sequence of said nucleotide sequence, or (c) both
    (a) and (b).
    [7]
    7. An isolated polynuc1eotide whose nucleotide sequence has a sequence identity of at least 80% with (a) the sequence encoding a polypeptide having the amino acid sequence presented in SEQ ID NO 3 from amino acid residue number 128 to 200, or
    (b) the complementary sequence of said nucleotide sequence, or (c) both (a) and (b).
    [8]
    8. The polynuc1eotides isolated in claims 1 to 7 in the form of DNA
    [9]
    9. The polynuc1eotides isolated in claims 1 to 7 in the form of
    RNA
    [10]
    10. A 200 amino acid sbGnIH precursor polypeptide having a sequence identity of at least 80% with the sequence described in Figure 2 (SEQ ID NO 3) or a non-toxic salt thereof.
    [11]
    eleven. A 12 amino acid sbGnIH-1 peptide having a sequence identity of at least 80% with the NH2-PLHLHANMPMRFCOOH sequence (SEQ ID NO 4) or a non-toxic salt thereof.
    [12]
    12. A peptide as described in SEQ ID NO 4, modified with an amidation at its C-terminal end, which has a sequence identity of at least 80% with the sequence NH2-PLHLHANMPMRF-CONH2 (SEQ ID NO 6) or a non-toxic salt thereof.
    [13]
    13. A peptide as described in claims 11 and 12, in which 1 or more amino acids have been removed.
    [14]
    14. A peptide as described in claims 11 and 12, in which 1 or more amino acids have been added.
    [15]
    fifteen. A peptide as described in claims 11, 12, 13 and 14 in which 1 or more amino acids have been modified.
    [16]
    16. A 12 amino acid sbGnIH-2 peptide having a sequence identity of at least 80% with the NH2-SPNSTPNMPQRFCOOH sequence (SEQ ID NO 5) or a non-toxic salt thereof.
    [17]
    17. A peptide as described in SEQ ID NO 5, modified with an amidation at its C-terminal end, which has a sequence identity of at least 80% with the sequence NH2-SPNSTPNMPQRF-CONH2 (SEQ ID NO 7) or a non-toxic salt thereof.
    [18]
    18. A peptide as described in claims 16 and which 1 or more amino acids have been removed. 17, inthe
    s 19. A peptide as described in claims 16 and which 1 or more amino acids have been added.17, inthe
    [20]
    20. A peptide as described in claims 16, 17, 18 and 19, in which 1 or more amino acids have been modified.
    10 21. An antibody capable of specifically binding peptides having a sequence identity of at least 80% with the peptides described in claims 11 and 12.
    lS 22. The use of the antibody described in claim 21 in immunocytochemical and immunohistochemical, Westem-blot, BIot, ELISA and EIA.Dot techniques
    twenty 23. An antibody capable of specifically binding peptides having a sequence identity of at least 80% with the peptides described in claims 16 and 17.
    2S 24. The use of the antibody described in claim 23 in immunocytochemical and immunohistochemical, Westem-blot, BIot, ELISA and EIA.Dot techniques
    [25]
    25. A method of inhibiting or stimulating fish reproduction by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptide described in
    claim 12 (NH2-PLHLHANMPMRF-CONH2, SEQ ID NO 6) or
    a non-toxic salt thereof.
    [26]
    26. A method according to claim 25, wherein said administration is by injection.
    [27]
    27. A method according to claim 25, wherein said administration is implantation.
    [28]
    28. A method according to claim 25, wherein said administration is by dissolving in water in which the fish are swimming.
    [29]
    29. A method according to claim 25, wherein said administration is orally through feeding.
    [30]
    30 A method according to claim 25, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.
    [31]
    31. A method of inhibiting fish reproduction by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptide described in claim 17 (NH2-SPNSTPNMPQRF-CONH2, SEQ ID NO 7) or a non-toxic salt thereof.
    [32]
    32 A method according to claim 31, wherein said administration is by injection.
    [33]
    33. A method according to claim 31, wherein said administration is implantation.
    [34]
    3. 4. A method according to claim 31, wherein said administration is by dissolving in water in which the fish are swimming.
    [35]
    35 A method according to claim 31, wherein said administration is orally through feeding.
    [36]
    36. A method according to claim 31, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.
    [37]
    37. A method of inhibiting or stimulating the reproduction of fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10,11,13,14 , 15,16,18, 19 and 20
    [38]
    38. A method according to claim 37, wherein said administration is by injection.
    [39]
    39. A method according to claim 37, wherein said administration is implantation.
    [40]
    40 A method according to claim 37, wherein said administration is by dissolving in water in which the fish are swimming.
    [41]
    41. A method according to claim 37, wherein said administration is orally through feeding.
    [42]
    42 A method according to claim 37, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.
    [43]
    43 A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19 and 20.
    [44]
    44. A method according to claim 43, wherein said administration is by injection.
    [45]
    Four. Five. A method according to claim 43, wherein said administration is implantation.
    [46]
    46. A method according to claim 43, wherein said administration is by dissolving in water in which the fish are swimming.
    [47]
    47 A method according to claim 43, wherein said administration is orally through feeding.
    [48]
    48. A method according to claim 43, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.
    [49]
    49. A method of inhibiting or stimulating the intake of fish by administering to said fish an effective amount of a peptide having a sequence identity of at least 80% with the peptides described in claims 10,11,12,13 , 14,15,16,17,18, 19 and 20.
    [50]
    fifty. A method according to claim 49, wherein said administration is by injection.
    [51]
    51. A method according to claim 49, wherein said administration is implantation.
    [52]
    52 A method according to claim 49, wherein said administration is by dissolving in water in which the fish are swimming.
    [53]
    53. A method according to claim 49, wherein said administration is orally through feeding.
    [54]
    54 A method according to claim 49, wherein said administration is by transgenesis through a vector that includes a promoter that allows to express or stop expressing said peptide at will.
    [55]
    55. A method of inhibiting or stimulating the reproduction of the fish by administering to said fish an effective amount of po1inucleotides having a sequence identity of at least 80% with the po1inucleotides described in claims 8 and 9.
    [56]
    56. A method according to claim 55, wherein said administration is by injection.
    [57]
    57. A method according to claim 55, wherein said administration is implantation.
    [58]
    58. A method according to claim 55, wherein said administration is by dissolving in water in which the fish are swimming.
    [59]
    59. A method according to claim 55, wherein said administration is orally through feeding.
    [60]
    60 A method according to claim 55, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said po1inucleotide at will.
    [61]
    61. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of po1inucleotides having a sequence identity of at least 80% with the po1inucleotides described in claims 8 and 9.
    [62]
    62 A method according to claim 61, wherein said administration is by injection.
    [63]
    63. A method according to claim 61, wherein said administration is implantation.
    [64]
    64. A method according to claim 61, wherein said administration is by dissolving in water in which the fish are swimming.
    [65]
    65 A method according to claim 61, wherein said administration is orally through feeding.
    [66]
    66. A method according to claim 61, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said polynucleotide at will.
    [67]
    67. A method of inhibiting or stimulating the intake of fish by administering to said fish an effective amount of polynucleotides having a sequence identity of at least 80% with the polynucleotides described in claims 8 and 9.
    [68]
    68. A method according to claim 67, wherein said administration is by injection.
    [69]
    69. A method according to claim 67, wherein said administration is implantation.
    [70]
    70. A method according to claim 67, wherein said administration is by dissolving in water in which the fish are swimming.
    [71]
    71. A method according to claim 67, wherein said administration is orally through feeding.
    [72]
    72. A method according to claim 67, wherein said administration is by transgenesis through a vector that includes a promoter that allows overexpressing or ceasing to express said po1inucleotide at will.
    [73]
    73 A method of inhibiting or stimulating the reproduction of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.
    [74]
    74. A method according to claim 73, wherein said administration is by injection.
    [75]
    75. A method according to claim 73, wherein said administration is implantation.
    [76]
    76 A method according to claim 73, wherein said administration is by dissolving in water in which the fish are swimming.
    [77]
    77. A method according to claim 73, wherein said administration is orally through feeding.
    [78]
    78. A method of inhibiting or stimulating the growth of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.
    [79]
    79. A method according to claim 78, wherein said administration is by injection.
    [80]
    80. A method according to claim 78, wherein said administration is implantation.
    [81]
    81. A method according to claim 78, wherein said administration is by dissolving in water in which the fish are swimming.
    [82]
    82. A method according to claim 78, wherein said administration is orally through feeding.
    [83]
    83. A method of inhibiting or stimulating the intake of the fish by administering to said fish an effective amount of the antibodies described in claims 21 and 23.
    [84]
    84. A method according to claim 83, wherein said administration is by injection.
    [85]
    85. A method according to claim 83, wherein said administration is implantation.
    [86]
    86. A method according to claim 83, wherein said administration is by dissolving in water in which the fish are swimming.
    [87]
    87. A method according to claim 83, wherein said administration is orally through feeding.
    类似技术:
    公开号 | 公开日 | 专利标题
    Sébert et al.2008|Melatonin activates brain dopaminergic systems in the eel with an inhibitory impact on reproductive function
    Weltzien et al.2004|The brain–pituitary–gonad axis in male teleosts, with special emphasis on flatfish |
    Whittington et al.2013|The role of prolactin in fish reproduction
    Mazurais et al.1999|Central melatonin receptors in the rainbow trout: comparative distribution of ligand binding and gene expression
    Migaud et al.2012|Kisspeptin and seasonal control of reproduction in male European sea bass |
    Selvaraj et al.2013|Subcutaneous administration of Kiss1 pentadecapeptide accelerates spermatogenesis in prepubertal male chub mackerel |
    Guzmán et al.2009|Comparative gene expression of gonadotropins | and peptide levels of gonadotropin-releasing hormones | in the pituitary of wild and cultured Senegalese sole | broodstocks
    Aliaga‐Guerrero et al.2018|Gonadotropin‐inhibitory hormone in the flatfish, Solea senegalensis: Molecular cloning, brain localization and physiological effects
    Ohta et al.2008|Sexually dimorphic expression of pituitary glycoprotein hormones in a sex‐changing fish |
    Luckenbach et al.2010|Regulation of pituitary GnRH receptor and gonadotropin subunits by IGF1 and GnRH in prepubertal male coho salmon
    Pandian2013|Endocrine sex differentiation in fish
    Wang et al.2017|Molecular characterization of Kiss2 receptor and in vitro effects of Kiss2 on reproduction-related gene expression in the hypothalamus of half-smooth tongue sole |
    Stewart et al.2013|Cloning of the crustacean hyperglycemic hormone and evidence for molt-inhibiting hormone within the central nervous system of the blue crab Portunus pelagicus
    Degani et al.2010|cDNA cloning of blue gourami | prolactin and its expression during the gonadal cycles of males and females
    US7521057B2|2009-04-21|Lamprey GnRH-III polypeptides and methods of making thereof
    Paullada-Salmerón et al.2019|The gonadotropin-inhibitory hormone system of fish: The case of sea bass |
    Clark et al.2002|Calcitonin: characterisation and expression in a teleost fish, Fugu rubripes
    Tuziak et al.2013|Gonadotrophin-releasing hormone in winter flounder |: Molecular characterization, distribution and effects of fasting
    ES2561708B2|2016-06-30|Gonadotrophin inhibitor hormone | and its use to control puberty, reproduction, intake and growth in fish
    Ahmed et al.2012|Effect of food restriction on reproductive-related genes and reproductive hormones in adult female rats
    Morin et al.2015|Identification and expression of GnRH2 and GnRH3 in the black sea bass |, a hermaphroditic teleost
    Zhang et al.2004|cDNA sequence and spatio-temporal expression of prolactin in the orange-spotted grouper, Epinephelus coioides
    Degani et al.2006|cDNA cloning and mRNA expression of growth hormone in Belontiidae |
    Servili et al.2014|Neuroendocrine regulation of reproduction in sea bass
    Zhao et al.2018|Characterization and differential expression of three GnRH forms during reproductive development in cultured turbot Schophthalmus maximus
    同族专利:
    公开号 | 公开日
    ES2561708B2|2016-06-30|
    WO2016016478A1|2016-02-04|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US5643877A|1994-12-05|1997-07-01|University Of Maryland Biotechnology Institute|Compounds comprising gonadotropin releasing hormone and methods for controlling reproduction in fish|
    US6949365B2|2002-06-12|2005-09-27|University Of New Hampshire|Polynucleotides encoding lamprey GnRH-III|CN107058391A|2017-05-05|2017-08-18|湖南农业大学|A kind of slow virus carrier of high efficient expression mouse gonadotropin inhibiting hormonegene and its application|
    法律状态:
    2016-06-30| FG2A| Definitive protection|Ref document number: 2561708 Country of ref document: ES Kind code of ref document: B2 Effective date: 20160630 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201400644A|ES2561708B2|2014-07-31|2014-07-31|Gonadotrophin inhibitor hormoneand its use to control puberty, reproduction, intake and growth in fish|ES201400644A| ES2561708B2|2014-07-31|2014-07-31|Gonadotrophin inhibitor hormoneand its use to control puberty, reproduction, intake and growth in fish|
    PCT/ES2014/000196| WO2016016478A1|2014-07-31|2014-11-20|Gonadotropin-inhibitory hormoneand use thereof to control the puberty, reproduction, ingestion and growth of fish|
    [返回顶部]